Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCACCACCAGCCACGGACCCACGA[C/T]TGCCACTCACAACCCCACCACCACC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 153634 MIM: 602641 MIM: 604041 MIM: 612844 MIM: 601297 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CD68 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CD68 - CD68 molecule | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040059.1 | 418 | Missense Mutation | ACT,ATT | T,I 49 | NP_001035148.1 | |
NM_001251.2 | 418 | Missense Mutation | ACT,ATT | T,I 76 | NP_001242.2 |
EIF4A1 - eukaryotic translation initiation factor 4A1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204510.1 | 418 | Intron | NP_001191439.1 | |||
NM_001416.3 | 418 | Intron | NP_001407.1 |
LOC100996842 - uncharacterized LOC100996842 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MPDU1 - mannose-P-dolichol utilization defect 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SENP3 - SUMO1/sentrin/SMT3 specific peptidase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SENP3-EIF4A1 - SENP3-EIF4A1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA48 - small nucleolar RNA, H/ACA box 48 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA67 - small nucleolar RNA, H/ACA box 67 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD10 - small nucleolar RNA, C/D box 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SOX15 - SRY-box 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |