Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTCACTGATGATGGTGGAGAAAGT[A/G]CCAGATTCAACTTATGAGATGATTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601681 MIM: 601736 | ||||||||||||||||||||
Literature Links: |
FTSJ3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FTSJ3 - FtsJ homolog 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSMC5 - proteasome 26S subunit, ATPase 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199163.1 | 510 | Silent Mutation | GTA,GTG | V,V 135 | NP_001186092.1 | |
NM_002805.5 | 510 | Silent Mutation | GTA,GTG | V,V 143 | NP_002796.4 |
SMARCD2 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |