Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGACCAGTTCACTACTCAGATGCA[C/T]GTCTCCTTGGTGCCTTGACCATTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604171 MIM: 614534 MIM: 607996 MIM: 602679 | ||||||||||||||||||||
Literature Links: |
ALYREF PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALYREF - Aly/REF export factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ANAPC11 - anaphase promoting complex subunit 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002244.2 | 491 | Missense Mutation | ACG,ATG | T,M 110 | NP_001002244.1 | |
NM_001002245.2 | 491 | Intron | NP_001002245.1 | |||
NM_001002246.2 | 491 | Intron | NP_001002246.1 | |||
NM_001002247.2 | 491 | Intron | NP_001002247.1 | |||
NM_001002248.2 | 491 | Intron | NP_001002248.1 | |||
NM_001002249.2 | 491 | Intron | NP_001002249.1 | |||
NM_001289414.1 | 491 | Intron | NP_001276343.1 | |||
NM_001289415.1 | 491 | Intron | NP_001276344.1 | |||
NM_001289416.1 | 491 | Intron | NP_001276345.1 | |||
NM_001289417.1 | 491 | Intron | NP_001276346.1 | |||
NM_001289418.1 | 491 | Intron | NP_001276347.1 | |||
NM_001289419.1 | 491 | Intron | NP_001276348.1 | |||
NM_001289420.1 | 491 | Intron | NP_001276349.1 | |||
NM_016476.11 | 491 | Intron | NP_057560.8 |
NPB - neuropeptide B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCYT2 - phosphate cytidylyltransferase 2, ethanolamine | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |