Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGAGCTGGGCGGGGCGCCTAGGA[G/T]GTTGGCGGCAACTCTTCCCCACTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611508 MIM: 131370 MIM: 610056 | ||||||||||||||||||||
Literature Links: |
CAMTA2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CAMTA2 - calmodulin binding transcription activator 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ENO3 - enolase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPAG7 - sperm associated antigen 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004890.2 | 1336 | Silent Mutation | NP_004881.2 | |||
XM_006721600.2 | 1336 | Silent Mutation | XP_006721663.1 |