Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGGCTGTACTGAAGAAAGAAAACT[G/T]CAACATGATGAATGCCCTTGACCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602954 | ||||||||||||||||||||
Literature Links: |
FNDC8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FNDC8 - fibronectin type III domain containing 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017559.2 | 147 | Missense Mutation | TGC,TTC | C,F 22 | NP_060029.1 |
NLE1 - notchless homolog 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAD51D - RAD51 paralog D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAD51L3-RFFL - RAD51L3-RFFL readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |