Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAGGAAAAGGCGGCAGACAGGCT[A/G]GAGCAGGAGTTGCTCCGAGGTAGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614271 MIM: 180073 | ||||||||||||||||||||
Literature Links: |
ARL16 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARL16 - ADP ribosylation factor like GTPase 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCDC137 - coiled-coil domain containing 137 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_199287.2 | 499 | Silent Mutation | CTA,CTG | L,L 187 | NP_954981.1 | |
XM_011524738.2 | 499 | Silent Mutation | CTA,CTG | L,L 59 | XP_011523040.1 | |
XM_017024573.1 | 499 | Intron | XP_016880062.1 |
OXLD1 - oxidoreductase like domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDE6G - phosphodiesterase 6G | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |