Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACGGGTCCAACCTCGAACTGTGTCC[C/T]TGTCATCAATGAGCAGGTCCCCCAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 191720 | ||||||||||||||||||||
Literature Links: |
ARMC7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARMC7 - armadillo repeat containing 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304271.1 | 525 | Intron | NP_001291200.1 | |||
NM_001304272.1 | 525 | Intron | NP_001291201.1 | |||
NM_001304273.1 | 525 | Intron | NP_001291202.1 | |||
NM_024585.3 | 525 | Intron | NP_078861.1 |
HN1 - hematological and neurological expressed 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NT5C - 5', 3'-nucleotidase, cytosolic | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001252377.1 | 525 | Intron | NP_001239306.1 | |||
NM_014595.2 | 525 | Missense Mutation | AAG,AGG | K,R 146 | NP_055410.1 | |
XM_011524700.2 | 525 | Intron | XP_011523002.2 |