Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTCACATCACATCCTTGTGCTCC[T/A]GCTTGGACTCCTTAATGACCTGCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614677 MIM: 603892 MIM: 137780 | ||||||||||||||||||||
Literature Links: |
CCDC103 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC103 - coiled-coil domain containing 103 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EFTUD2 - elongation factor Tu GTP binding domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GFAP - glial fibrillary acidic protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001131019.2 | 1414 | Intron | NP_001124491.1 | |||
NM_001242376.1 | 1414 | Intron | NP_001229305.1 | |||
NM_002055.4 | 1414 | Missense Mutation | CAG,CTG | Q,L 426 | NP_002046.1 | |
XM_017024451.1 | 1414 | Missense Mutation | CAG,CTG | Q,L 466 | XP_016879940.1 |