Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCACCACCTCCAAGCAAAAAGTGG[C/T]TTGTGAAGACGCTGAAAACCTCCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607763 MIM: 609848 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ACAP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ACAP1 - ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCTD11 - potassium channel tetramerization domain containing 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM95 - transmembrane protein 95 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320435.1 | 447 | Missense Mutation | CTT,TTT | L,F 173 | NP_001307364.1 | |
NM_001320436.1 | 447 | Silent Mutation | GGC,GGT | G,G 175 | NP_001307365.1 | |
NM_198154.2 | 447 | Silent Mutation | GGC,GGT | G,G 183 | NP_937797.1 | |
XM_017024565.1 | 447 | Missense Mutation | GCT,GTT | A,V 146 | XP_016880054.1 | |
XM_017024566.1 | 447 | Missense Mutation | GCT,GTT | A,V 119 | XP_016880055.1 | |
XM_017024567.1 | 447 | Missense Mutation | GCT,GTT | A,V 112 | XP_016880056.1 | |
XM_017024568.1 | 447 | Silent Mutation | GGC,GGT | G,G 175 | XP_016880057.1 | |
XM_017024569.1 | 447 | Silent Mutation | GGC,GGT | G,G 175 | XP_016880058.1 | |
XM_017024570.1 | 447 | Missense Mutation | CTT,TTT | L,F 86 | XP_016880059.1 | |
XM_017024571.1 | 447 | Missense Mutation | GCT,GTT | A,V 146 | XP_016880060.1 |