Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGTCCTTGAGCTCCGGCCGCGCA[C/T]TCCGCTTGGCCTCGCGGATGCGCTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604914 MIM: 615262 MIM: 600813 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
JMJD6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
JMJD6 - arginine demethylase and lysine hydroxylase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001081461.1 | 368 | Missense Mutation | NP_001074930.1 | |||
NM_015167.2 | 368 | Missense Mutation | NP_055982.2 |
METTL23 - methyltransferase like 23 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080510.4 | 368 | Intron | NP_001073979.3 | |||
NM_001206983.2 | 368 | Intron | NP_001193912.1 | |||
NM_001206984.2 | 368 | Intron | NP_001193913.1 | |||
NM_001206985.2 | 368 | Intron | NP_001193914.1 | |||
NM_001206986.2 | 368 | Intron | NP_001193915.1 | |||
NM_001206987.2 | 368 | Intron | NP_001193916.1 | |||
NM_001302703.1 | 368 | Intron | NP_001289632.1 | |||
NM_001302704.1 | 368 | Intron | NP_001289633.1 | |||
NM_001302705.1 | 368 | Intron | NP_001289634.1 | |||
XM_006721674.3 | 368 | Intron | XP_006721737.1 | |||
XM_006721675.1 | 368 | Intron | XP_006721738.1 | |||
XM_006721676.3 | 368 | Intron | XP_006721739.1 | |||
XM_006721678.3 | 368 | Intron | XP_006721741.1 | |||
XM_006721679.3 | 368 | Intron | XP_006721742.1 | |||
XM_006721680.2 | 368 | Intron | XP_006721743.1 | |||
XM_011524282.1 | 368 | Intron | XP_011522584.1 | |||
XM_017024145.1 | 368 | Intron | XP_016879634.1 | |||
XM_017024146.1 | 368 | Intron | XP_016879635.1 |
SRSF2 - serine and arginine rich splicing factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |