Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAAAGCCCCCCTCCAGCCCGAGAC[A/G]TCTGCTGACTTCTATCGTGATTGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614677 MIM: 603892 MIM: 137780 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CCDC103 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CCDC103 - coiled-coil domain containing 103 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001258395.1 | 445 | Silent Mutation | ACA,ACG | T,T 101 | NP_001245324.1 | |
NM_001258396.1 | 445 | Silent Mutation | ACA,ACG | T,T 101 | NP_001245325.1 | |
NM_001258397.1 | 445 | UTR 3 | NP_001245326.1 | |||
NM_001258398.1 | 445 | Missense Mutation | ATC,GTC | I,V 102 | NP_001245327.1 | |
NM_001258399.1 | 445 | Missense Mutation | ATC,GTC | I,V 103 | NP_001245328.1 | |
NM_213607.2 | 445 | Silent Mutation | ACA,ACG | T,T 101 | NP_998772.1 |
EFTUD2 - elongation factor Tu GTP binding domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GFAP - glial fibrillary acidic protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |