Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCGGCTCAGCCCCAGTCCAGCCC[C/G]GTGCAGGCCACGTTTGAGGTTCTTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609855 MIM: 109684 MIM: 602976 MIM: 608665 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
COASY PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
COASY - Coenzyme A synthase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001042529.2 | 524 | Silent Mutation | CCC,CCG | P,P 57 | NP_001035994.1 | |
NM_001042532.3 | 524 | Silent Mutation | CCC,CCG | P,P 86 | NP_001035997.2 | |
NM_025233.6 | 524 | Silent Mutation | CCC,CCG | P,P 57 | NP_079509.5 | |
XM_006722116.3 | 524 | Silent Mutation | CCC,CCG | P,P 86 | XP_006722179.1 | |
XM_011525300.1 | 524 | Silent Mutation | CCC,CCG | P,P 57 | XP_011523602.1 | |
XM_017025167.1 | 524 | Silent Mutation | CCC,CCG | P,P 57 | XP_016880656.1 | |
XM_017025168.1 | 524 | Intron | XP_016880657.1 |
HSD17B1 - hydroxysteroid 17-beta dehydrogenase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MLX - MLX, MAX dimerization protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PSMC3IP - PSMC3 interacting protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |