Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGAGCGGTCCCTGCAGGGGAGTC[C/T]AGCTTCACCTTGTCCAGGATGGTCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602020 MIM: 179035 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MAFG PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MAFG - MAF bZIP transcription factor G | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAFG-AS1 - MAFG antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYADML2 - myeloid associated differentiation marker like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PYCR1 - pyrroline-5-carboxylate reductase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001282279.1 | 948 | Silent Mutation | CTA,CTG | L,L 261 | NP_001269208.1 | |
NM_001282280.1 | 948 | Silent Mutation | CTA,CTG | L,L 292 | NP_001269209.1 | |
NM_001282281.1 | 948 | Silent Mutation | CTA,CTG | L,L 319 | NP_001269210.1 | |
NM_006907.3 | 948 | Silent Mutation | CTA,CTG | L,L 292 | NP_008838.2 | |
NM_153824.2 | 948 | Intron | NP_722546.1 | |||
XM_005256381.2 | 948 | Silent Mutation | CTA,CTG | L,L 292 | XP_005256438.1 | |
XM_011523583.2 | 948 | Silent Mutation | CTA,CTG | L,L 292 | XP_011521885.1 | |
XM_011523584.2 | 948 | Silent Mutation | CTA,CTG | L,L 292 | XP_011521886.1 | |
XM_011523585.2 | 948 | UTR 3 | XP_011521887.1 | |||
XM_017024909.1 | 948 | UTR 3 | XP_016880398.1 |