Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACCTCCTCCTCCTTGCTCAAACTG[G/T]CTGGCTGGGCCAGCCGGAAGAGGCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606006 MIM: 612072 MIM: 611974 MIM: 606521 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GGA3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GGA3 - golgi associated, gamma adaptin ear containing, ARF binding protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100287042 - uncharacterized LOC100287042 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIF4GD - MIF4G domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242498.1 | 679 | Missense Mutation | GAC,GCC | D,A 181 | NP_001229427.1 | |
NM_001242500.1 | 679 | Missense Mutation | GAC,GCC | D,A 174 | NP_001229429.1 | |
NM_001242501.1 | 679 | Missense Mutation | GAC,GCC | D,A 140 | NP_001229430.1 | |
NM_020679.3 | 679 | Missense Mutation | GAC,GCC | D,A 174 | NP_065730.2 | |
XM_005257530.1 | 679 | Missense Mutation | GAC,GCC | D,A 181 | XP_005257587.1 | |
XM_005257532.4 | 679 | Missense Mutation | GAC,GCC | D,A 140 | XP_005257589.1 | |
XM_005257533.1 | 679 | Missense Mutation | GAC,GCC | D,A 140 | XP_005257590.1 | |
XM_011525051.2 | 679 | Missense Mutation | GAC,GCC | D,A 249 | XP_011523353.1 | |
XM_011525052.2 | 679 | Missense Mutation | GAC,GCC | D,A 242 | XP_011523354.1 | |
XM_011525053.2 | 679 | Missense Mutation | GAC,GCC | D,A 208 | XP_011523355.1 | |
XM_011525054.2 | 679 | Missense Mutation | GAC,GCC | D,A 197 | XP_011523356.1 | |
XM_011525055.2 | 679 | Missense Mutation | GAC,GCC | D,A 156 | XP_011523357.1 | |
XM_011525057.2 | 679 | Missense Mutation | GAC,GCC | D,A 88 | XP_011523359.1 | |
XM_017024888.1 | 679 | Missense Mutation | GAC,GCC | D,A 249 | XP_016880377.1 | |
XM_017024889.1 | 679 | Missense Mutation | GAC,GCC | D,A 181 | XP_016880378.1 | |
XM_017024890.1 | 679 | Missense Mutation | GAC,GCC | D,A 181 | XP_016880379.1 | |
XM_017024891.1 | 679 | Missense Mutation | GAC,GCC | D,A 181 | XP_016880380.1 | |
XM_017024892.1 | 679 | Missense Mutation | GAC,GCC | D,A 156 | XP_016880381.1 | |
XM_017024893.1 | 679 | Missense Mutation | GAC,GCC | D,A 140 | XP_016880382.1 | |
XM_017024894.1 | 679 | Missense Mutation | GAC,GCC | D,A 140 | XP_016880383.1 | |
XM_017024895.1 | 679 | Missense Mutation | GAC,GCC | D,A 122 | XP_016880384.1 |
MRPS7 - mitochondrial ribosomal protein S7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A19 - solute carrier family 25 member 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |