Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGACTACAAGTCTTGTGCTCATGA[C/T]TGGGTCTATGAATAAGAGGTGGACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 156490 MIM: 156491 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MBTD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MBTD1 - mbt domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NME1 - NME/NM23 nucleoside diphosphate kinase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NME1-NME2 - NME1-NME2 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018136.2 | 561 | Silent Mutation | GAC,GAT | D,D 263 | NP_001018146.1 |
NME2 - NME/NM23 nucleoside diphosphate kinase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018137.2 | 561 | Silent Mutation | GAC,GAT | D,D 148 | NP_001018147.1 | |
NM_001018138.1 | 561 | Intron | NP_001018148.1 | |||
NM_001018139.2 | 561 | Intron | NP_001018149.1 | |||
NM_001198682.1 | 561 | UTR 3 | NP_001185611.1 | |||
NM_002512.3 | 561 | Silent Mutation | GAC,GAT | D,D 148 | NP_002503.1 |