Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGACGTAGTAGGTGCTCAATA[AATA/-]TGTTGTTGAATGCGCTTCAGTCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604182 MIM: 608855 | ||||||||||||||||||||
Literature Links: |
MGC16275 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MGC16275 - uncharacterized protein MGC16275 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL38 - ribosomal protein L38 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTYH2 - tweety family member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032646.5 | Intron | NP_116035.5 | ||||
NM_052869.1 | Intron | NP_443101.1 | ||||
XM_005257824.3 | Intron | XP_005257881.1 |