Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACACTCACATCTTCTTGCTGCTTTC[A/G]CAGCTCCATCTTGTTAGCCCGCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610664 | ||||||||||||||||||||
Literature Links: |
KIAA0100 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KIAA0100 - KIAA0100 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014680.3 | 5792 | Nonsense Mutation | CGA,TGA | R,* 1897 | NP_055495.2 | |
XM_005258073.2 | 5792 | Nonsense Mutation | CGA,TGA | R,* 1896 | XP_005258130.1 | |
XM_017025423.1 | 5792 | Nonsense Mutation | CGA,TGA | R,* 1754 | XP_016880912.1 |
SGK494 - uncharacterized serine/threonine-protein kinase SgK494 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPAG5-AS1 - SPAG5 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |