Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAACATCTTGGCCTTGATCTTCTTC[C/T]GCTGCTTCCGGACAGCCACCTTCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607300 MIM: 607848 MIM: 607873 | ||||||||||||||||||||
Literature Links: |
PRPF8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PRPF8 - pre-mRNA processing factor 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RILP - Rab interacting lysosomal protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_031430.2 | 1187 | Missense Mutation | NP_113618.2 | |||
XM_005256811.1 | 1187 | Missense Mutation | XP_005256868.1 | |||
XM_017025195.1 | 1187 | Silent Mutation | XP_016880684.1 |
SCARF1 - scavenger receptor class F member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |