Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACATTGCTGATCTGCTCCTTGAGC[A/C]GGCAGATGACCTTGCGCTGGCCCCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605828 MIM: 610741 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
TMC6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
TMC6 - transmembrane channel like 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001127198.2 | 2310 | Missense Mutation | NP_001120670.1 | |||
NM_001321185.1 | 2310 | Missense Mutation | NP_001308114.1 | |||
NM_007267.7 | 2310 | Missense Mutation | NP_009198.4 | |||
XM_005256995.1 | 2310 | Missense Mutation | XP_005257052.1 | |||
XM_011524255.1 | 2310 | Missense Mutation | XP_011522557.1 | |||
XM_011524256.1 | 2310 | Missense Mutation | XP_011522558.1 | |||
XM_011524257.2 | 2310 | Missense Mutation | XP_011522559.1 | |||
XM_011524258.1 | 2310 | Intron | XP_011522560.1 | |||
XM_017024107.1 | 2310 | Missense Mutation | XP_016879596.1 | |||
XM_017024108.1 | 2310 | Missense Mutation | XP_016879597.1 | |||
XM_017024109.1 | 2310 | Missense Mutation | XP_016879598.1 |
TNRC6C - trinucleotide repeat containing 6C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNRC6C-AS1 - TNRC6C antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |