Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCTTTAACGCCCGTGAGACCAGC[C/G]AGGATGCCAAGTGTGTGGTCAGCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603060 | ||||||||||||||||||||
Literature Links: |
INCA1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
INCA1 - inhibitor of CDK, cyclin A1 interacting protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001167985.1 | 412 | Intron | NP_001161457.1 | |||
NM_001167986.1 | 412 | Intron | NP_001161458.1 | |||
NM_001167987.1 | 412 | Intron | NP_001161459.1 | |||
NM_213726.2 | 412 | Intron | NP_998891.2 |
KIF1C - kinesin family member 1C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006612.5 | 412 | Missense Mutation | CAG,GAG | Q,E 22 | NP_006603.2 | |
XM_005256424.2 | 412 | Missense Mutation | CAG,GAG | Q,E 22 | XP_005256481.1 |
LOC101927979 - translation initiation factor IF-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |