Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCTGGGCCATCTTCTGTAACAAC[C/T]GACAGAAAATGTAAATATACCTGTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604334 MIM: 616463 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC101928000 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC101928000 - uncharacterized LOC101928000 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP6 - ubiquitin specific peptidase 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF232 - zinc finger protein 232 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001320952.1 | 769 | Intron | NP_001307881.1 | |||
NM_001320953.1 | 769 | Silent Mutation | TCA,TCG | S,S 190 | NP_001307882.1 | |
NM_001320954.1 | 769 | Silent Mutation | TCA,TCG | S,S 190 | NP_001307883.1 | |
NM_001320955.1 | 769 | Silent Mutation | TCA,TCG | S,S 189 | NP_001307884.1 | |
NM_014519.3 | 769 | Silent Mutation | TCA,TCG | S,S 217 | NP_055334.2 | |
XM_011524006.2 | 769 | Silent Mutation | TCA,TCG | S,S 169 | XP_011522308.1 | |
XM_017025021.1 | 769 | Silent Mutation | TCA,TCG | S,S 217 | XP_016880510.1 | |
XM_017025022.1 | 769 | Silent Mutation | TCA,TCG | S,S 141 | XP_016880511.1 | |
XM_017025023.1 | 769 | Intron | XP_016880512.1 |