Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGCAGGCCTCGCAGTACCGTGATG[C/T]TGACGAACGTTTTCCCGGGGACGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 131370 MIM: 176610 MIM: 610431 MIM: 604165 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ENO3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ENO3 - enolase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001193503.1 | 819 | Intron | NP_001180432.1 | |||
NM_001976.4 | 819 | Intron | NP_001967.3 | |||
NM_053013.3 | 819 | Intron | NP_443739.3 | |||
XM_005256521.2 | 819 | Intron | XP_005256578.1 | |||
XM_011523729.1 | 819 | Intron | XP_011522031.1 | |||
XM_017024346.1 | 819 | Intron | XP_016879835.1 |
PFN1 - profilin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005022.3 | 819 | Missense Mutation | AAC,AGC | N,S 42 | NP_005013.1 | |
XM_017024761.1 | 819 | Missense Mutation | AAC,AGC | N,S 42 | XP_016880250.1 |
RNF167 - ring finger protein 167 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A11 - solute carrier family 25 member 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |