Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCATACTCACCTTAAAAGGATCC[A/G]AATTGCTAAGTTCCCCTGAAGAAGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600673 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ASB16-AS1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ASB16-AS1 - ASB16 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ATXN7L3 - ataxin 7 like 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001098833.1 | 880 | Intron | NP_001092303.1 | |||
NM_020218.1 | 880 | Intron | NP_064603.1 | |||
XM_011525038.2 | 880 | Intron | XP_011523340.1 | |||
XM_011525044.2 | 880 | Intron | XP_011523346.1 | |||
XM_011525046.2 | 880 | Intron | XP_011523348.1 | |||
XM_017024880.1 | 880 | Missense Mutation | TCG,TTG | S,L 213 | XP_016880369.1 | |
XM_017024881.1 | 880 | Missense Mutation | TCG,TTG | S,L 213 | XP_016880370.1 | |
XM_017024882.1 | 880 | Intron | XP_016880371.1 | |||
XM_017024883.1 | 880 | Missense Mutation | TCG,TTG | S,L 206 | XP_016880372.1 | |
XM_017024884.1 | 880 | Missense Mutation | TCG,TTG | S,L 199 | XP_016880373.1 | |
XM_017024885.1 | 880 | Missense Mutation | TCG,TTG | S,L 187 | XP_016880374.1 | |
XM_017024886.1 | 880 | Missense Mutation | TCG,TTG | S,L 180 | XP_016880375.1 |
LOC101926967 - uncharacterized LOC101926967 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMUB2 - transmembrane and ubiquitin like domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBTF - upstream binding transcription factor, RNA polymerase I | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |