Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGGTGGTTGGTCCCCAGGCTGTG[A/G]GGGTGACATATGGGACCGGGAGAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 147681 MIM: 603638 | ||||||||||||||||||||
Literature Links: |
IL11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IL11 - interleukin 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL28 - ribosomal protein L28 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM190 - transmembrane protein 190 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_139172.1 | 119 | Missense Mutation | GAG,GGG | E,G 34 | NP_631911.1 | |
XM_017026331.1 | 119 | Intron | XP_016881820.1 |
TMEM238 - transmembrane protein 238 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |