Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCGGAAGACCGGCCACGTCATTGC[C/T]GTTAAGGTGAGCCTTGGCGGCTACC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612891 MIM: 603014 MIM: 605076 | ||||||||||||||||||||
Literature Links: |
LRRC8E PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LRRC8E - leucine rich repeat containing 8 family member E | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP2K7 - mitogen-activated protein kinase kinase 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297555.1 | 654 | Silent Mutation | GCC,GCT | A,A 163 | NP_001284484.1 | |
NM_001297556.1 | 654 | Silent Mutation | GCC,GCT | A,A 147 | NP_001284485.1 | |
NM_145185.3 | 654 | Silent Mutation | GCC,GCT | A,A 147 | NP_660186.1 | |
XM_006722800.2 | 654 | Silent Mutation | GCC,GCT | A,A 163 | XP_006722863.1 |
SNAPC2 - small nuclear RNA activating complex polypeptide 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TGFBR3L - transforming growth factor beta receptor 3 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |