Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTCAGCCCTGGAGCCGATGCCAGC[C/G]CCGGAGTCGGTGCCAGTGCCGGGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612746 MIM: 608229 | ||||||||||||||||||||
Literature Links: |
C19orf57 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf57 - chromosome 19 open reading frame 57 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR181C - microRNA 181c | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR181D - microRNA 181d | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NANOS3 - nanos C2HC-type zinc finger 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001098622.2 | 1019 | Silent Mutation | GCC,GCG | A,A 51 | NP_001092092.1 | |
XM_011527964.2 | 1019 | Silent Mutation | GCC,GCG | A,A 51 | XP_011526266.1 |