Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTGGGGAAGCGCGGGTCGAAGGG[C/T]GGCGTCGACCATTTCCCCTTGGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 147681 MIM: 613198 | ||||||||||||||||||||
Literature Links: |
COX6B2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COX6B2 - cytochrome c oxidase subunit 6B2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144613.4 | 234 | Silent Mutation | CCA,CCG | P,P 17 | NP_653214.2 |
FAM71E2 - family with sequence similarity 71 member E2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145402.1 | 234 | Intron | NP_001138874.1 |
IL11 - interleukin 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KMT5C - lysine methyltransferase 5C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |