Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCGCCCCAACCCACCTCGATCTT[C/T]TCCTCGATAAGCTGCTTGGCGTGGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603445 MIM: 610822 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
KHSRP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
KHSRP - KH-type splicing regulatory protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003685.2 | 1444 | Silent Mutation | GAA,GAG | E,E 493 | NP_003676.2 | |
XM_005259668.4 | 1444 | Silent Mutation | GAA,GAG | E,E 493 | XP_005259725.1 | |
XM_011528395.2 | 1444 | Silent Mutation | GAA,GAG | E,E 449 | XP_011526697.1 | |
XM_017027408.1 | 1444 | Silent Mutation | GAA,GAG | E,E 449 | XP_016882897.1 | |
XM_017027409.1 | 1444 | Silent Mutation | GAA,GAG | E,E 449 | XP_016882898.1 | |
XM_017027410.1 | 1444 | Silent Mutation | GAA,GAG | E,E 349 | XP_016882899.1 |
LOC390877 - adenylate kinase isoenzyme 1-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3940 - microRNA 3940 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A41 - solute carrier family 25 member 41 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |