Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCTGCTCCACCGTGGGGGGCGCTG[A/G]GCGGGTGGGCAGCAGCACGCGCTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612034 MIM: 600487 | ||||||||||||||||||||
Literature Links: |
APC2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
APC2 - APC2, WNT signaling pathway regulator | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C19orf25 - chromosome 19 open reading frame 25 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152482.2 | 128 | Missense Mutation | CCA,TCA | P,S 15 | NP_689695.2 | |
XM_005259506.3 | 128 | Missense Mutation | CCA,TCA | P,S 15 | XP_005259563.1 | |
XM_006722653.3 | 128 | Missense Mutation | CCA,TCA | P,S 15 | XP_006722716.1 | |
XM_017026374.1 | 128 | Missense Mutation | CCA,TCA | P,S 58 | XP_016881863.1 |
PCSK4 - proprotein convertase subtilisin/kexin type 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |