Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACCTCCTGCCCCACAGTGCCCGTC[C/T]GTGATGATGGGAACATGCCCGACGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603832 MIM: 606862 MIM: 606419 MIM: 609519 | ||||||||||||||||||||
Literature Links: |
NDUFA3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NDUFA3 - NADH:ubiquinone oxidoreductase subunit A3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004542.3 | 616 | Missense Mutation | CGT,TGT | R,C 58 | NP_004533.1 | |
XM_017026833.1 | 616 | Missense Mutation | CGT,TGT | R,C 58 | XP_016882322.1 |
OSCAR - osteoclast associated, immunoglobulin-like receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRPF31 - pre-mRNA processing factor 31 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TFPT - TCF3 fusion partner | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321792.1 | 616 | Intron | NP_001308721.1 | |||
NM_013342.3 | 616 | Intron | NP_037474.1 | |||
XM_005278261.1 | 616 | Intron | XP_005278318.1 |