Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCGAGGGCCACGCACATCCCAGG[A/G]TAGTGGAGCTACCCAAGACGGATGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612331 MIM: 603144 MIM: 180740 | ||||||||||||||||||||
Literature Links: |
C19orf73 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf73 - chromosome 19 open reading frame 73 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LIN7B - lin-7 homolog B, crumbs cell polarity complex component | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308419.1 | 321 | Intron | NP_001295348.1 | |||
NM_022165.2 | 321 | Missense Mutation | ATA,GTA | I,V 93 | NP_071448.1 | |
XM_006723323.3 | 321 | Missense Mutation | ATA,GTA | I,V 69 | XP_006723386.1 | |
XM_017027131.1 | 321 | Intron | XP_016882620.1 |
PPFIA3 - PTPRF interacting protein alpha 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNRNP70 - small nuclear ribonucleoprotein U1 subunit 70 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |