Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTTGGTGGTGTTGTCACAAGGGA[C/T]GTCACCCCAGGACACAATGCCCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 147910 MIM: 610601 | ||||||||||||||||||||
Literature Links: |
KLK1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KLK1 - kallikrein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KLK15 - kallikrein related peptidase 15 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001277081.1 | 1510 | Missense Mutation | ATC,GTC | I,V 227 | NP_001264010.1 | |
NM_001277082.1 | 1510 | UTR 3 | NP_001264011.1 | |||
NM_017509.3 | 1510 | Missense Mutation | ATC,GTC | I,V 228 | NP_059979.2 | |
XM_006723265.3 | 1510 | Missense Mutation | ATC,GTC | I,V 228 | XP_006723328.1 | |
XM_011527085.2 | 1510 | Missense Mutation | ATC,GTC | I,V 227 | XP_011525387.1 | |
XM_011527087.2 | 1510 | Missense Mutation | ATC,GTC | I,V 143 | XP_011525389.1 | |
XM_011527088.2 | 1510 | UTR 3 | XP_011525390.1 | |||
XM_011527089.2 | 1510 | UTR 3 | XP_011525391.1 | |||
XM_017026943.1 | 1510 | Intron | XP_016882432.1 |
LOC105372441 - uncharacterized LOC105372441 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MGC45922 - uncharacterized LOC284365 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |