Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGCAGGAGTCCCATGATGAGATT[A/G]TACAGGACCCTCCAGGGTGAGGGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605854 | ||||||||||||||||||||
Literature Links: |
BBC3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BBC3 - BCL2 binding component 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001127240.2 | 783 | Nonsense Mutation | CAA,TAA | Q,* 207 | NP_001120712.1 | |
NM_001127241.2 | 783 | Silent Mutation | TAC,TAT | Y,Y 110 | NP_001120713.1 | |
NM_001127242.2 | 783 | Nonsense Mutation | CAA,TAA | Q,* 47 | NP_001120714.1 | |
NM_014417.4 | 783 | Silent Mutation | TAC,TAT | Y,Y 172 | NP_055232.1 | |
XM_006723141.3 | 783 | Silent Mutation | TAC,TAT | Y,Y 172 | XP_006723204.1 | |
XM_011526722.2 | 783 | Silent Mutation | TAC,TAT | Y,Y 188 | XP_011525024.1 |
MIR3190 - microRNA 3190 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3191 - microRNA 3191 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |