Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGTGTGAGTCTTTTCATGATAGC[A/G]AAAGGAAGTGGAAGAAATAAATCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
LOC101928464 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC101928464 - uncharacterized LOC101928464 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF433 - zinc finger protein 433 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF878 - zinc finger protein 878 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080404.2 | 1145 | Missense Mutation | CGC,TGC | R,C 327 | NP_001073873.2 | |
XM_017027195.1 | 1145 | Intron | XP_016882684.1 | |||
XM_017027196.1 | 1145 | Intron | XP_016882685.1 |