Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTGCGGAGGGTGGTGGGACAACT[A/G]GATCCACAGCGTCTCTGGAGCACTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 137241 MIM: 601061 | ||||||||||||||||||||
Literature Links: |
GIPR PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GIPR - gastric inhibitory polypeptide receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
QPCTL - glutaminyl-peptide cyclotransferase like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001163377.1 | 564 | Silent Mutation | CTA,CTG | L,L 88 | NP_001156849.1 | |
NM_017659.3 | 564 | Silent Mutation | CTA,CTG | L,L 88 | NP_060129.2 | |
XM_011527048.2 | 564 | Silent Mutation | CTA,CTG | L,L 88 | XP_011525350.1 | |
XM_017026900.1 | 564 | Silent Mutation | CTA,CTG | L,L 88 | XP_016882389.1 |
SNRPD2 - small nuclear ribonucleoprotein D2 polypeptide | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |