Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCAATCGGTGGCCCACACCAGCCC[C/T]ACGGCGCCCACAGCGCCCCATGTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603573 MIM: 147141 MIM: 609711 | ||||||||||||||||||||
Literature Links: |
MBD3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MBD3 - methyl-CpG binding domain protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCF3 - transcription factor 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UQCR11 - ubiquinol-cytochrome c reductase, complex III subunit XI | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006830.3 | 165 | Silent Mutation | NP_006821.1 |