Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCCCGCGGATCGCCTACCACCTG[C/T]GTGGCCAGCGCTGGCCCTTCGGGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608841 MIM: 602779 MIM: 607777 | ||||||||||||||||||||
Literature Links: |
CPAMD8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CPAMD8 - C3 and PZP like, alpha-2-macroglobulin domain containing 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
F2RL3 - F2R like thrombin/trypsin receptor 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003950.2 | 408 | Missense Mutation | NP_003941.2 | |||
XM_005260139.2 | 408 | Missense Mutation | CGT,TGT | R,C 26 | XP_005260196.1 |
SIN3B - SIN3 transcription regulator family member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |