Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCCTCCTGGGGCAGCTGCAGGTAC[A/G]GGTTGTTTCCTGTGGGCTGGAACTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604504 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GPR108 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GPR108 - G protein-coupled receptor 108 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080452.1 | 1544 | Missense Mutation | CCG,CTG | P,L 503 | NP_001073921.1 | |
XM_006722801.3 | 1544 | Missense Mutation | CCG,CTG | P,L 261 | XP_006722864.1 | |
XM_011528137.2 | 1544 | Missense Mutation | CCG,CTG | P,L 261 | XP_011526439.1 | |
XM_017027012.1 | 1544 | Missense Mutation | CGT,TGT | R,C 514 | XP_016882501.1 | |
XM_017027013.1 | 1544 | Missense Mutation | CCG,CTG | P,L 484 | XP_016882502.1 | |
XM_017027014.1 | 1544 | Missense Mutation | CGT,TGT | R,C 495 | XP_016882503.1 | |
XM_017027015.1 | 1544 | Missense Mutation | CGT,TGT | R,C 272 | XP_016882504.1 |
MIR6791 - microRNA 6791 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRIP10 - thyroid hormone receptor interactor 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |