Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGACCCTCAACAGATACCAGCGT[G/T]TGTATAGAACTTCCAAATGCTGAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604945 MIM: 604946 | ||||||||||||||||||||
Literature Links: |
KIR2DL4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KIR2DL4 - killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080770.1 | 1026 | Silent Mutation | GTG,GTT | V,V 294 | NP_001074239.1 | |
NM_001080772.1 | 1026 | UTR 3 | NP_001074241.1 | |||
NM_002255.5 | 1026 | Silent Mutation | GTG,GTT | V,V 329 | NP_002246.5 |
KIR3DL1 - killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC102724300 - uncharacterized LOC102724300 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |