Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCCTGGCTAAAGAGCTGCTGCTG[A/C]AGAACGTTGTTGAGGGCGTGGACAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614545 MIM: 615324 | ||||||||||||||||||||
Literature Links: |
ASPDH PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ASPDH - aspartate dehydrogenase domain containing | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EMC10 - ER membrane protein complex subunit 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
JOSD2 - Josephin domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001270639.1 | 198 | Silent Mutation | CTG,CTT | L,L 33 | NP_001257568.1 | |
NM_001270640.1 | 198 | Silent Mutation | CTG,CTT | L,L 33 | NP_001257569.1 | |
NM_001270641.1 | 198 | Silent Mutation | CTG,CTT | L,L 33 | NP_001257570.1 | |
NM_001270686.1 | 198 | Silent Mutation | CTG,CTT | L,L 33 | NP_001257615.1 | |
NM_138334.3 | 198 | Silent Mutation | CTG,CTT | L,L 33 | NP_612207.1 | |
XM_011526434.2 | 198 | Silent Mutation | CTG,CTT | L,L 33 | XP_011524736.1 |
LRRC4B - leucine rich repeat containing 4B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |