Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACTTGCCGCTCCCCAGAACCTGGA[C/G]CTTCCTCCTCCATCGGATCTCCCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613478 MIM: 191318 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CCDC106 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CCDC106 - coiled-coil domain containing 106 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107983998 - uncharacterized LOC107983998 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
U2AF2 - U2 small nuclear RNA auxiliary factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF580 - zinc finger protein 580 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF581 - zinc finger protein 581 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016535.3 | 277 | Missense Mutation | CCT,GCT | P,A 35 | NP_057619.1 | |
XM_006723240.3 | 277 | Missense Mutation | CCT,GCT | P,A 35 | XP_006723303.1 | |
XM_017026867.1 | 277 | Missense Mutation | CCT,GCT | P,A 35 | XP_016882356.1 |