Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACCTGGGCCGGGGGCAGTGGGAGA[C/T]GCATTGGCACTGACACAAGCACAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616561 | ||||||||||||||||||||
Literature Links: |
MIR1470 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR1470 - microRNA 1470 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RASAL3 - RAS protein activator like 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022904.1 | 2323 | Missense Mutation | CAT,CGT | H,R 749 | NP_075055.1 | |
XM_011528185.1 | 2323 | Missense Mutation | CAT,CGT | H,R 752 | XP_011526487.1 | |
XM_011528186.1 | 2323 | Missense Mutation | CAT,CGT | H,R 746 | XP_011526488.1 | |
XM_011528187.1 | 2323 | Missense Mutation | CAT,CGT | H,R 752 | XP_011526489.1 |
WIZ - widely interspaced zinc finger motifs | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |