Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCGCGGCTTCCGGATCCTTGGTCT[G/T]CGGTGAGTGCCTGAGTCTCCAGCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601240 MIM: 601825 | ||||||||||||||||||||
Literature Links: |
GAMT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GAMT - guanidinoacetate N-methyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MUM1 - melanoma associated antigen (mutated) 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFS7 - NADH:ubiquinone oxidoreductase core subunit S7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024407.4 | 94 | Silent Mutation | CTG,CTT | L,L 17 | NP_077718.3 | |
XM_005259556.4 | 94 | Silent Mutation | CTG,CTT | L,L 17 | XP_005259613.2 | |
XM_017026768.1 | 94 | Silent Mutation | CTG,CTT | L,L 102 | XP_016882257.1 |