Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGACACACTCTCCCCCTGCAGAG[A/G]TCCAGGGGACCCAACAGCCCCAGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608083 MIM: 600745 MIM: 604783 | ||||||||||||||||||||
Literature Links: |
APOC2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
APOC2 - apolipoprotein C2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000483.4 | 165 | Missense Mutation | ATC,GTC | I,V 20 | NP_000474.2 |
APOC4 - apolipoprotein C4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
APOC4-APOC2 - APOC4-APOC2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CLPTM1 - CLPTM1, transmembrane protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |