Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCCCCATCGACCGGTACTGGACAC[C/G]CTGGCCATGCTGACTGCCCACCGTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608095 MIM: 605834 MIM: 612112 MIM: 600607 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LYSMD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LYSMD1 - LysM domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCNM1 - sodium channel modifier 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204856.1 | 345 | Silent Mutation | ACC,ACG | T,T 20 | NP_001191785.1 | |
NM_024041.3 | 345 | Silent Mutation | ACC,ACG | T,T 55 | NP_076946.1 |
TMOD4 - tropomodulin 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFAIP8L2 - TNF alpha induced protein 8 like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFAIP8L2-SCNM1 - TNFAIP8L2-SCNM1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204848.1 | 345 | Silent Mutation | ACC,ACG | T,T 20 | NP_001191777.1 |
VPS72 - vacuolar protein sorting 72 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |