Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGACAAGAAGTTGCTGTTGTGCATC[A/C]GCTGCTTCCGCGACATGCAGAAGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 616923 MIM: 180474 | ||||||||||||||||||||
Literature Links: |
LOC102724450 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC102724450 - uncharacterized LOC102724450 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF207 - ring finger protein 207 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_207396.2 | 703 | Missense Mutation | AGC,CGC | S,R 177 | NP_997279.2 | |
XM_011541439.2 | 703 | Missense Mutation | AGC,CGC | S,R 225 | XP_011539741.1 | |
XM_017001259.1 | 703 | Missense Mutation | AGC,CGC | S,R 177 | XP_016856748.1 |
RPL22 - ribosomal protein L22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |