Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAAGGTTTACAAGCAGGCCACGA[C/T]TGAATCTCTGAAGGTGAGAGGGGAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
9 submissions
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
MIR4781 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR4781 - microRNA 4781 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCEANC2 - transcription elongation factor A N-terminal and central domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_153035.2 | 318 | Missense Mutation | ACT,ATT | T,I 30 | NP_694580.1 | |
XM_017000293.1 | 318 | Missense Mutation | ACT,ATT | T,I 30 | XP_016855782.1 |
TMEM59 - transmembrane protein 59 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001305043.1 | 318 | Intron | NP_001291972.1 | |||
NM_001305049.1 | 318 | Intron | NP_001291978.1 | |||
NM_001305050.1 | 318 | Intron | NP_001291979.1 | |||
NM_001305051.1 | 318 | Intron | NP_001291980.1 | |||
NM_001305052.1 | 318 | Intron | NP_001291981.1 | |||
NM_001305066.1 | 318 | Intron | NP_001291995.1 | |||
NM_004872.4 | 318 | Intron | NP_004863.2 | |||
XM_006711051.1 | 318 | Intron | XP_006711114.1 |