Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGCCAGGGCAACACCACATAGAG[C/T]TCCAAGGAGACCTTCTCCACTATTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
6 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606225 MIM: 165270 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
TAS1R1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
TAS1R1 - taste 1 receptor member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138697.3 | 481 | Missense Mutation | CTC,TTC | L,F 129 | NP_619642.2 | |
NM_177540.2 | 481 | Missense Mutation | CTC,TTC | L,F 129 | NP_803884.1 | |
XM_011542203.2 | 481 | Missense Mutation | CTC,TTC | L,F 51 | XP_011540505.1 | |
XM_011542206.2 | 481 | Missense Mutation | CTC,TTC | L,F 131 | XP_011540508.1 | |
XM_017002402.1 | 481 | Missense Mutation | CTC,TTC | L,F 131 | XP_016857891.1 | |
XM_017002403.1 | 481 | Missense Mutation | CTC,TTC | L,F 131 | XP_016857892.1 |
ZBTB48 - zinc finger and BTB domain containing 48 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |