Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGGGACCAACCTACCCTTGAAGCC[A/G]TGTGCCCGGGCGTCCTTTGAGGTGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606210 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AUNIP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AUNIP - aurora kinase A and ninein interacting protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC646471 - uncharacterized LOC646471 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MTFR1L - mitochondrial fission regulator 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099625.1 | 318 | Silent Mutation | CCA,CCG | P,P 36 | NP_001093095.1 | |
NM_001099626.1 | 318 | Silent Mutation | CCA,CCG | P,P 36 | NP_001093096.1 | |
NM_001099627.1 | 318 | Silent Mutation | CCA,CCG | P,P 36 | NP_001093097.1 | |
NM_019557.5 | 318 | Silent Mutation | CCA,CCG | P,P 36 | NP_062457.3 |
SEPN1 - selenoprotein N, 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |