Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAATGGGGGGCCACTGCCTGAAAGC[C/T]GGGCCAAGGCCCTCTTCCGTCAGAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607660 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BSDC1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BSDC1 - BSD domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001143888.2 | 769 | Intron | NP_001137360.1 | |||
NM_001143889.2 | 769 | Intron | NP_001137361.1 | |||
NM_001143890.2 | 769 | Intron | NP_001137362.1 | |||
NM_001300958.1 | 769 | Intron | NP_001287887.1 | |||
NM_018045.7 | 769 | Intron | NP_060515.3 | |||
XM_005270986.4 | 769 | Intron | XP_005271043.1 | |||
XM_011541677.2 | 769 | Intron | XP_011539979.1 |
FAM229A - family with sequence similarity 229 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSSK3 - testis specific serine kinase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_052841.3 | 769 | Missense Mutation | CGG,TGG | R,W 110 | NP_443073.1 |